lyophilization is one of those subjects where the details matter more than the headlines. This page pulls together the background, the mechanisms, and the practical points readers ask about most.
Last reviewed on 2026-04-16. Where a claim depends on a specific study, the study is described rather than over-claimed.
Purity is ordinarily reported as a percentage from reverse-phase high-performance liquid chromatography, where the area of the main peak is compared with the total peak area. Identity is confirmed by mass spectrometry, since the measured mass can be checked against the value calculated from the sequence. Some certificates also include amino acid analysis or sequence confirmation by tandem mass spectrometry. A single purity number does not describe the profile of related impurities, so the underlying chromatogram and spectrum usually carry more information than the headline figure.
Material of this kind is sold for laboratory research, and labels typically state that it is not intended for human or veterinary use. In many countries it is not an approved medicine, and sports antidoping rules place it among prohibited non-approved substances. Buyers commonly review a certificate of analysis, an independent test report, and the declared storage conditions. Batch-to-batch variation in purity and in counterion content is possible, and how much that variation affects experimental outcomes remains an open question.
Terminology in the literature is not fully standardised. Papers and product listings use BPC-157, BPC 157, and the longer phrase stable gastric pentadecapeptide BPC 157 interchangeably, and synonyms such as bepecin or PL 14736 appear in older or company-linked publications. Purity claims and reported masses can also differ between sources because peptide preparations may include counterions, residual solvents, or bound water. This variability complicates direct comparison of results across studies and makes the exact identity and grade of a given sample worth verifying. Discussions of the compound should therefore specify the source, salt form, and stated purity where those are known.
BPC-157 is a synthetic peptide composed of fifteen amino acid residues, with the sequence Gly-Glu-Pro-Pro-Pro-Gly-Lys-Pro-Ala-Asp-Asp-Ala-Gly-Leu-Val. Its name derives from body protection compound, a term used for a protein fraction identified in human gastric juice. Researchers in Zagreb first reported the pentadecapeptide in the early 1990s and described it as a stable fragment of that larger protein. The compound is also catalogued as PL 14736 and, in some commercial contexts, as bepecin. Its molecular formula is C62H98N16O22 and its monoisotopic mass is approximately 1419 daltons.
| Property | Value | Notes |
|---|---|---|
| Typical storage | Minus 20 C or below | Lyophilized powder, protected from light |
| Solubility class | Freely soluble in water | Also dissolves in normal saline |
| Identity method | Mass spectrometry | Measured mass compared with calculated value |
| Purity method | Reverse-phase HPLC | Reported as area percentage of main peak |
| Common counterion | Acetate | Salt form varies by supplier and batch |
Quality assessment rests on two separate questions: whether the chain is the intended one, and how much of the sample is that chain. Reverse-phase high-performance liquid chromatography with ultraviolet detection is the standard purity measurement, while mass spectrometry confirms identity through the observed molecular mass. Amino acid analysis and sequence verification provide further checks. A reported purity percentage describes the proportion of the sample represented by the main peak, not the amount of peptide by mass, since counter-ions and water make up part of any lyophilized lot.
In its usual supplied form, the peptide is a white to off-white lyophilized powder that dissolves readily in water and in aqueous buffers. Powder keeps far longer than solution, so material is normally shipped and stored dry, then dissolved only when needed. Once in solution, the chain is subject to hydrolysis and the liquid supports microbial growth, and practical guidance generally treats the dissolved form as short-lived. Containers should stay sealed and desiccated, because the powder takes up moisture from air.
The sequence places several glycine and proline residues near the middle, which may influence how the chain folds in solution. The peptide is linear rather than cyclic, and it carries no disulfide bridges. Commercial material is commonly supplied as the acetate salt, although the free base and other counterion forms also appear. Because the term BPC-157 refers to a specific sequence, samples with slight sequence variants are chemically different substances. Published work generally treats the fifteen-residue sequence as the defining structure.
Physical descriptions in supplier documents and papers usually list the compound as a white to off-white powder. It dissolves readily in water and in common aqueous buffers, and solutions are often prepared fresh before an experiment. Molecular mass near 1419 daltons helps verify identity during mass spectrometry. The powder is somewhat hygroscopic, so moisture exposure can alter the measured mass of a sample. Purity is typically reported as a percentage from chromatographic analysis.
BPC-157 is a synthetic fifteen-amino-acid peptide whose sequence is GEPPPGKPADDAGLV. Its name derives from the phrase body protection compound, a term applied to a protein fraction originally detected in human gastric juice. The short peptide is not that full protein; it corresponds to a stable fragment of the larger molecule. Researchers frequently describe it as a pentadecapeptide because it contains exactly fifteen residues. Its neutral molecular mass is approximately 1419 daltons.
Proposed mechanisms include interaction with the nitric oxide system, modulation of growth factor signaling, and effects on blood vessel formation. None of these has been established as the primary mode of action, and some proposed pathways rest on indirect measurements. Whether the reported effects depend on a specific receptor has not been determined. Stability in gastric acid, unusual for a peptide of this size, is also reported in animal work, but the reason for it is not firmly established.
Published studies on BPC-157 are dominated by animal models. Commonly used endpoints include healing of surgically induced lesions in the stomach, tendon-to-bone attachment after transection, and recovery from experimentally induced vascular or intestinal damage. Many of these reports come from a small number of research groups, and the peptide is often described as acting across a wide range of tissue types. That breadth is itself a point of discussion, since one molecule influencing many unrelated systems is unusual.
== Usage as doping product == As a performance-enhancing drug, EPO has been banned since the early 1990s, but a test was not available until the 2000 Summer Olympics. Before this test was available, some athletes were sanctioned after confessing to having used EPO, for example in the Festina affair, when a car with doping products for the Festina cycling team was found. The first doping test in cycling was used in the 2001 La Flèche Wallonne. The first rider to test positive in that race was Bo Hamburger, although he was later acquitted because his B-sample was not conclusive. The U.S. Postal Service Pro Cycling Team, under the leadership of Lance Armstrong and Johan Bruyneel, ran a sophisticated doping program that lasted for many years during the late 1990s and early 2000s. Erythropoietin was a common substance used by the cyclists. Studies of the effectiveness of EPO in cycling consistently associate EPO with an increase in subjects' maximal aerobic capacity, but yield mixed results as to the drug's effects on submaximal aerobic efforts. A 2007 study showed that EPO treatment led to a statistically significant improvement in cyclists' abilities to maintain a "submaximal" effort of about 80% of their pre-treatment aerobic maximum (VO2max). The study found that subjects treated with EPO saw increased VO2max values, and the amount of time they could maintain their initial submaximal effort also increased.
Turns are classified by their backbone dihedral angles (see Ramachandran plot). A turn can be converted into its inverse turn (in which the main chain atoms have opposite chirality) by changing the sign on its dihedral angles. (The inverse turn is not a true enantiomer since the Cα atom chirality is maintained.) Thus, the γ-turn has two forms, a classical form with (φ, ψ) dihedral angles of roughly (75°, −65°) and an inverse form with dihedral angles (−75°, 65°). At least eight forms of the beta turn occur, varying in whether a cis isomer of a peptide bond is involved and on the dihedral angles of the central two residues. The classical and inverse β-turns are distinguished with a prime, e.g., type I and type I′ beta turns. If an i → i + 3 hydrogen bond is taken as the criterion for turns, the four categories of Venkatachalam (I, II, II′, I′) suffice to describe all possible beta turns. All four occur frequently in proteins but I is most common, followed by II, I′ and II′ in that order.
== Annexation == Gqozo refused to participate in the negotiations to agree to a post-apartheid constitution for South Africa, and initially threatened to boycott the first non-racial elections. This became unsustainable, and in March 1994, Ciskei government workers went on strike for fear of losing their job security and pensions in the post-apartheid era. The police then mutinied, prompting Gqozo to resign on 22 March. The Transitional Executive Council (TEC) appointed two administrators, who took control of the homeland to ensure security until the elections could be held the following month. The TEC also blocked the South African government from deploying the paramilitary Internal Stability Unit (ISU) of the South African Police force, as the unit was suspected of fomenting violence in other parts of the country after the Ciskei military had threatened to open fire on the ISU if it entered the territory. On 27 April 1994, Ciskei and all of the other homelands were reincorporated into South Africa, after the first post-apartheid elections. Along with Transkei, Ciskei became part of the new Eastern Cape Province, with its capital becoming the capital of the new province, and the former territory of the Ciskei forming parts of the Buffalo City Metropolitan Municipality, the Chris Hani District Municipality, and the Amathole District Municipality—as of 2016.
Cephalosporins are a broad class of bactericidal antibiotics that include the β-lactam ring and share a structural similarity and mechanism of action with other β-lactam antibiotics (e.g. penicillins, carbapenems and monobactams). The cephalosporins (and other β-lactams) have the ability to kill bacteria by inhibiting essential steps in the bacterial cell wall synthesis which in the end results in osmotic lysis and death of the bacterial cell. Cephalosporins are widely used antibiotics because of their clinical efficiency and desirable safety profile. The cephalosporins are diverse in their antibacterial spectrum, water solubility, acid tolerability, oral bioavailability, biological half-life and other properties. Therefore, the cephalosporins can be further classified into generations depending on antibacterial activity, time of invention and structural basis.
== Isolation/Synthesis == Calciseptine is only found in the black mamba and can be purified from the crude venom. The snake can be milked to acquire the venom. Schweitz et al. used a three-step method to purify calciseptine to homology. The three steps were: 1) gel filtration, 2) ion exchange on TSK SP 5PW and 3) reverse-phase chromatography on RP18. Scientists also succeeded in synthesizing calciseptine in the lab. FS2, which is another component of the black mamba's venom and is homologous to calciseptine, can also be synthesized in the lab.
Sources: en.wikipedia.org
In glycolysis, glucose and glycerol are metabolized to pyruvate. Glycolysis generates two equivalents of ATP through substrate phosphorylation catalyzed by two enzymes, phosphoglycerate kinase (PGK) and pyruvate kinase. Two equivalents of nicotinamide adenine dinucleotide (NADH) are also produced, which can be oxidized via the electron transport chain and result in the generation of additional ATP by ATP synthase. The pyruvate generated as an end-product of glycolysis is a substrate for the citric acid cycle. Glycolysis is viewed as consisting of two phases with five steps each. In phase 1, "the preparatory phase", glucose is converted to 2 d-glyceraldehyde-3-phosphate (g3p). One ATP is invested in Step 1, and another ATP is invested in Step 3. Steps 1 and 3 of glycolysis are referred to as "Priming Steps". In Phase 2, two equivalents of g3p are converted to two pyruvates. In Step 7, two ATP are produced. Also, in Step 10, two further equivalents of ATP are produced. In Steps 7 and 10, ATP is generated from ADP. A net of two ATPs is formed in the glycolysis cycle. The glycolysis pathway is later associated with the Citric Acid Cycle, which produces additional equivalents of ATP. Glycolysis is regulated allosterically by a number of metabolic compounds. For example, hexokinase is directly inhibited by its product, glucose-6-phosphate, and pyruvate kinase is inhibited by ATP itself. The main control point for the glycolytic pathway is phosphofructokinase 1 (PFK1), which is allosterically inhibited by high concentrations of ATP and activated by high concentrations of AMP.
Émilie du Châtelet (1706–1749) proposed and tested the hypothesis of the conservation of total energy, as distinct from momentum. Inspired by the theories of Gottfried Leibniz, she repeated and publicized an experiment originally devised by Willem 's Gravesande in 1722 in which balls were dropped from different heights into a sheet of soft clay. Each ball's kinetic energy—as indicated by the quantity of material displaced—was shown to be proportional to the square of the velocity. The deformation of the clay was found to be directly proportional to the height from which the balls were dropped, equal to the initial potential energy. Some earlier workers, including Newton and Voltaire, had believed that "energy" was not distinct from momentum and therefore proportional to velocity. According to this understanding, the deformation of the clay should have been proportional to the square root of the height from which the balls were dropped. In classical physics, the correct formula is
==== TCR β-chain selection ==== At the DN2 stage (CD44+CD25+), cells upregulate the recombination genes RAG1 and RAG2 and re-arrange the TCRβ locus, combining V-D-J recombination and constant region genes in an attempt to create a functional TCRβ chain. As the developing thymocyte progresses through to the DN3 stage (CD44−CD25+), the thymocyte expresses an invariant α-chain called pre-Tα alongside the TCRβ gene. If the rearranged β-chain successfully pairs with the invariant α-chain, signals are produced which cease rearrangement of the β-chain (and silence the alternate allele). Although these signals require the pre-TCR at the cell surface, they are independent of ligand binding to the pre-TCR. If the chains successfully pair a pre-TCR forms, and the cell downregulates CD25 and is termed a DN4 cell (CD25−CD44−). These cells then undergo a round of proliferation, and begin to re-arrange the TCRα locus during the double-positive stage.
In pre-life, a 31 nucleotide D loop minihelix (GCGGCGGUAGCCUAGCCUAGCCUACCGCCGC) was ligated to two 31 nucleotide anticodon loop minihelices (GCGGCGGCCGGGCU/???AACCCGGCCGCCGC; / indicates a U-turn conformation in the RNA backbone; ? indicates unknown base identity) to form the 93 nucleotide tRNA precursor. To generate type II tRNAs, a single internal 9 nucleotide deletion occurred within ligated acceptor stems (CCGCCGCGCGGCGG goes to GGCGG). To generate type I tRNAs, an additional, related 9 nucleotide deletion occurred within ligated acceptor stems within the variable loop region (CCGCCGCGCGGCGG goes to CCGCC). These two 9 nucleotide deletions are identical on complementary RNA strands. tRNAomes (all of the tRNAs of an organism) were generated by duplication and mutation. Very clearly, life evolved from a polymer world that included RNA repeats and RNA inverted repeats (stem-loop-stems). Of particular importance were the 7 nucleotide U-turn loops (CU/???AA). After LUCA (the last universal common (cellular) ancestor), the T loop evolved to interact with the D loop at the tRNA "elbow" (T loop: UU/CAAAU, after LUCA). Polymer world progressed to minihelix world to tRNA world, which has endured for ~4 billion years. Analysis of tRNA sequences reveals a major successful pathway in evolution of life on Earth.
CBGB, a club that was opened to play country, bluegrass & blues (as the name CBGB stands for), began to book Television, Patti Smith, and the Ramones as house bands in the mid-1970s. This spawned a full-blown scene of new bands (Talking Heads, Blondie, edgy R&B-influenced Mink DeVille, rockabilly revivalist Robert Gordon, and others) performing mostly original material in a mostly raw and often loud and fast attack. The label of punk rock was applied to the scene even if not all the bands that made their early reputations at the club were punk rockers, strictly speaking, but CBGB became known as the American cradle of punk rock. CBGB closed on October 31, 2006, after a long battle by club owner Hilly Kristal to extend its lease. The space is now a John Varvatos boutique.
Sources: en.wikipedia.org
=== Cited texts === Dhillon, Karminder Singh (2009). Malaysian Foreign Policy in the Mahathir Era 1981–2003: Dilemmas of Development. NUS Press. ISBN 978-9971-69-399-2. Milne, R. S.; Mauzy, Diane K. (1999). Malaysian Politics under Mahathir. Routledge. ISBN 0-415-17143-1. Morais, J. Victor (1982). Mahathir: A Profile in Courage. Eastern Universities Press. OCLC 8687329. Sankaran, Ramanathan; Mohd Hamdan Adnan (1988). Malaysia's 1986 General Election: the Urban-Rural Dichotomy. Institute of Southeast Asian Studies. ISBN 981-3035-12-9. Stewart, Ian (2003). The Mahathir Legacy: a Nation Divided, a Region at Risk. Allen & Unwin. ISBN 1-86508-977-X. Wain, Barry (2010). Malaysian Maverick: Mahathir Mohamad in Turbulent Times. Palgrave Macmillan. ISBN 978-0-230-23873-2. James Chin & Joern Dosch. Malaysia Post Mahathir: a decade of change?. Marshall Cavendish. 2016. ISBN 9814677558
== Further Information == ASTM E1588-10e1, Standard Guide for GSR analysis by Scanning Electron Microscopy/Energy Dispersive X-ray Spectrometry, American Society for Testing and Materials, West Conshohocken, PA, 2010. E. Boehm, Application of the SEM in forensic medicine, Scanning Electron Microscopy (1971) 553–560. M Christopher, J Warmenhoven, FS Romolo, M Donghi, R Webb, C Jeynes, NI Ward, A New Quantitative Method for Gunshot Residue Analysis by Ion Beam Analysis. Analyst, 2013, 138, 4649. O. Dalby, D. Butler, J.W. Birkett, Analysis of Gunshot Residue and Associated Materials—A Review, J. Forens. Sci. 55 (2010) 924–943. M. Grima, M. Butler, R. Hanson, A. Mohameden, Firework displays as sources of particles similar to gunshot residue, Science and Justice 52 (1) (2012) 49–57. H.H. Meng, B. Caddy, Gunshot residue analysis - review, J. Forens. Sci. 42 (1997) 553–570. P.V. Mosher, M.J. McVicar, E.D. Randall, E.H. Sild, Gunshot residue-similar particles produced by fireworks, Journal of the Canadian Society of Forens. Sci. 31 (3)(1998) 157–168. F.S. Romolo, M.E. Christopher, M. Donghi, L. Ripani, C. Jeynes, R.P. Webb, N.I. Ward, Integrated Ion Beam Analysis (IBA) in Gunshot Residue (GSR) characterisation. Forensic Sci. Int. 231 (2013), 219–228. F.S. Romolo. Advances in Analysis of Gunshot Residue. In Emerging Technologies for the analysis of forensic traces, Edited by Simona Francese, Springer Publishing Company, pagine 183–202, ISBN 978-3-030-20541-6. A.J. Schwoeble, D.L. Exline, Current Methods in Forensic Gunshot Residue Analysis, (2000) CRC Press LLC. J.S. Wallace, J.
germ cell Any cell that gives rise to the gametes of a sexually reproducing organism. Germ cells are the vessels for the genetic material which will ultimately be passed on to the organism's descendants and are usually distinguished from somatic cells, which are entirely separate from the germ line.
Sulfuric acid (American spelling and the preferred IUPAC name) or sulphuric acid (Commonwealth spelling), known in antiquity as oil of vitriol, is a mineral acid composed of the elements sulfur, oxygen, and hydrogen, with the molecular formula H2SO4. It is a colorless, odorless, and viscous liquid that is miscible with water. Pure sulfuric acid does not occur naturally due to its strong affinity to water vapor; it is hygroscopic and readily absorbs water vapor from the air. Concentrated sulfuric acid is a strong oxidant with powerful dehydrating properties, making it highly corrosive towards other materials, from rocks to metals. Phosphorus pentoxide is a notable exception in that it is not dehydrated by sulfuric acid but, to the contrary, dehydrates sulfuric acid to sulfur trioxide. When sulfuric acid is added to water, a considerable amount of heat is released; thus, the reverse procedure of adding water to the acid is generally avoided since the heat released may boil the solution, spraying droplets of hot acid during the process. Upon contact with body tissue, sulfuric acid can cause severe acidic chemical burns and secondary thermal burns due to dehydration. Dilute sulfuric acid is substantially less hazardous without the oxidative and dehydrating properties. Nonetheless, it must be handled with care due to its acidity. There are many methods for producing sulfuric acid, including the contact process, the wet sulfuric acid process, and the lead chamber process. It can be obtained by dissolving sulfur trioxide in water.
Sources: en.wikipedia.org
The standard approach is reverse-phase high-performance liquid chromatography, reported as a percentage of total peak area. Because that figure alone says little about the nature of the impurities, the accompanying chromatogram is normally the more useful document for judging a batch.
Cold storage at minus twenty degrees Celsius or below is the common recommendation for the lyophilized powder, together with protection from light and moisture. Dissolved material is generally treated as less stable and is handled cold with short working windows.
A useful certificate lists the analytical method used, the measured purity, the mass determined by spectrometry, and the storage conditions. Independent verification from a second laboratory is sometimes requested, since supplier-issued documents are not always produced in the same facility as the material.
BPC-157 is a synthetic fifteen-amino-acid peptide whose sequence corresponds to a fragment of a protein found in human gastric juice. It is studied mainly in preclinical research and is not an approved pharmaceutical product in major markets. Materials sold for laboratory use are typically labelled as research chemicals.